Need help with a program
Jean-Michel Pichavant
jeanmichel at sequans.com
Thu Jan 28 18:49:02 CET 2010
evilweasel wrote:
> I will make my question a little more clearer. I have close to 60,000
> lines of the data similar to the one I posted. There are various
> numbers next to the sequence (this is basically the number of times
> the sequence has been found in a particular sample). So, I would need
> to ignore the ones containing '0' and write all other sequences
> (excluding the number, since it is trivial) in a new text file, in the
> following format:
>
>
>> seq59902
>>
> TTTTTTTATAAAATATATAGT
>
>
>> seq59903
>>
> TTTTTTTATTTCTTGGCGTTGT
>
>
>> seq59904
>>
> TTTTTTTGGTTGCCCTGCGTGG
>
>
>> seq59905
>>
> TTTTTTTGTTTATTTTTGGG
>
> The number next to 'seq' is the line number of the sequence. When I
> run the above program, what I expect is an output file that is similar
> to the above output but with the ones containing '0' ignored. But, I
> am getting all the sequences printed in the file.
>
> Kindly excuse the 'newbieness' of the program. :) I am hoping to
> improve in the next few months. Thanks to all those who replied. I
> really appreciate it. :)
>
Using regexp may increase readability (if you are familiar with it).
What about
import re
output = open("sequences1.txt", 'w')
for index, line in enumerate(open(sys.argv[1], 'r')):
match = re.match('(?P<sequence>[GATC]+)\s+1')
if match:
output.write('seq%s\n%s\n' % (index, match.group('sequence')))
Jean-Michel
More information about the Python-list
mailing list