<div class="gmail_quote">On Thu, Jan 19, 2012 at 1:44 PM, Hs Hs <span dir="ltr"><<a href="mailto:ilhs_hs@yahoo.com">ilhs_hs@yahoo.com</a>></span> wrote:<br><blockquote class="gmail_quote" style="margin:0 0 0 .8ex;border-left:1px #ccc solid;padding-left:1ex">
<div><div style="font-size:12pt;font-family:times new roman,new york,times,serif">so I do not know what that pattern would be when I read in a string. I do not know if regex could solve my kind of problem too. <br></div></div>
</blockquote></div><br>Ignore the python portion of the problem for now. <br><br>Imagine someone handed you a piece of paper with the letters "AAATAGCAGAAATAAAAGAAAAGATTGGAACTAGGTCAG" written on it, and asked you to circle the section that you're trying to identify. How would you do it, without using a computer? How do you figure out where there was a mutation, and then how do you discover if that location is in a polymer region?<br>
<br>If you can describe that process to us, maybe we can help you turn that into a python program.<br><br>-- <br>Jerry<br>