how to store variable length string in array and get single char by it's position?
14 Sep
2010
14 Sep
'10
4:25 p.m.
Dear All, Suppose I have a list group some kind like DNA sequence: 1 ATGCATGCAATTGGCC 2 ATGCATGCAATTGGCCATCD 3 CATGCAATTGGCCCCCCCCC ...... 100000 CATGCAAATTGGCCCCCCCCC the string length of each item is not sure and may get change/update later, then how can I store above in a numpy array (include the ID) and easy to get the single value? for example 1. ATGCATGCAATTGGCC I want get the first T then I use something like array[1][1], means A[T]G...... and if I want to update the 3rd postion I can use array[1][2] = T to set the AT[G]C... to AT[T]C...? Thanks for any hints. Rgs, KC
4944
Age (days ago)
4944
Last active (days ago)
2 comments
3 participants
participants (3)
-
Bruce Southey
-
kee chen
-
Keith Goodman