slicing functionality for strings / Python suitability forbioinformatics
Tom Anderson
twic at urchin.earth.li
Wed Sep 21 06:37:38 EDT 2005
On Wed, 21 Sep 2005, Steven D'Aprano wrote:
> On Mon, 19 Sep 2005 19:40:12 -0700, jbperez808 wrote:
>
>> Having to do an array.array('c',...):
>>
>> >>> x=array.array('c','ATCTGACGTC')
>> >>> x[1:9:2]=array.array('c','AAAA')
>> >>> x.tostring()
>> 'AACAGACATC'
>>
>> is a bit klunkier than one would want, but I guess the efficient
>> performance is the silver lining here.
>
> There are a number of ways to streamline that. The simplest is to merely
> create an alias to array.array:
>
> from array import array as str
>
> Then you can say x = str('c', 'ATCTGACGTC').
>
> A little more sophisticated would be to use currying:
>
> def str(value):
> return array.array('c', value)
>
> x = str('ATCTGACGTC')
There's a special hell for people who override builtins.
> although to be frank I'm not sure that something as simple as this
> deserves to be dignified with the name currying.
It's definitely not currying - it doesn't create a new function. Currying
would be:
def arraytype(kind):
def mkarray(value):
return array.array(kind, value)
return mkarray
chars = arraytype('c')
seq = chars("tacatcgtcgacgtcgatcagtaccc")
> Lastly, you could create a wrapper class that implements everything you
> want. For a serious application, this is probably what you want to do
> anyway:
Definitely - there are lots of things to know about DNA molecules or parts
of them that aren't captured by the sequence.
tom
--
If it ain't Alberta, it ain't beef.
More information about the Python-list
mailing list