concatenate fasta file

[Grant Edwards]

On 2010-02-12, PeroMHC <macmanes at gmail.com> wrote:
> Hi All, I have  a simple problem that I hope somebody can help with. I
> have an input file (a fasta file) that I need to edit..
>
> Input file format
>
>>name 1
> tactcatacatac
>>name 2
> acggtggcat
>>name 3
> gggtaccacgtt
>
> I need to concatenate the sequences.. make them look like
>
>>concatenated
> tactcatacatacacggtggcatgggtaccacgtt

(echo "concantenated>"; grep '^ [actg]*$' inputfile | tr -d '\n'; echo) > outputfile

-- 
Grant