Need help with a program

Alf P. Steinbach alfps at start.no
Thu Jan 28 16:17:41 CET 2010


* evilweasel:
> Hi folks,
> 
> I am a newbie to python, and I would be grateful if someone could
> point out the mistake in my program. Basically, I have a huge text
> file similar to the format below:
> 
> AAAAAGACTCGAGTGCGCGGA	0
> AAAAAGATAAGCTAATTAAGCTACTGG	0
> AAAAAGATAAGCTAATTAAGCTACTGGGTT	 1
> AAAAAGGGGGCTCACAGGGGAGGGGTAT	 1
> AAAAAGGTCGCCTGACGGCTGC	0
> 
> The text is nothing but DNA sequences, and there is a number next to
> it. What I will have to do is, ignore those lines that have 0 in it,
> and print all other lines (excluding the number) in a new text file
> (in a particular format called as FASTA format). This is the program I
> wrote for that:
> 
> seq1 = []
> list1 = []
> lister = []
> listers = []
> listers1 = []
> a = []
> d = []
> i = 0
> j = 0
> num = 0
> 
> file1 = open(sys.argv[1], 'r')
> for line in file1:
>     if not line.startswith('\n'):
>         seq1 = line.split()
>         if len(seq1) == 0:
>             continue
> 
>         a = seq1[0]
>     	list1.append(a)
> 
>     	d = seq1[1]
>     	lister.append(d)
> 
> 
> b = len(lister)
> for j in range(0, b):
>     if lister[j] == 0:
>         listers.append(j)
>     else:
>         listers1.append(j)
> 
> 
> print listers1
> resultsfile = open("sequences1.txt", 'w')
> for i in listers1:
>     resultsfile.write('\n>seq' + str(i) + '\n' + list1[i] + '\n')
> 
> But this isn't working.

What do you mean by "isn't working"?


> I am not able to find the bug in this. I would
> be thankful if someone could point it out. Thanks in advance!

What do you expect as output, and what do you actually get as output?


Cheers,

- Alf



More information about the Python-list mailing list