regex multiple patterns in order

[km]

I am trying to find sub sequence patterns but constrained by the order in
which they occur
For example

>>> p = re.compile('(CAA)+?(TCT)+?(TA)+?')
>>> p.findall('CAACAACAATCTTCTTCTTCTTATATA')
[('CAA', 'TCT', 'TA')]

But I instead find only one instance of the CAA/TCT/TA in that order.
How can I get 3 matches of CAA, followed by  four matches of TCT followed
by 2 matches of TA ?
Well these patterns (CAA/TCT/TA) can occur any number of  times and atleast
once so I have to use + in the regex.

Please let me know.
Thanks!

Regards,
Krishna mohan
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.python.org/pipermail/python-list/attachments/20140120/594827dd/attachment.html>