[Tutor] finding a polymer of letters in a string

[Hilton Fernandes]

Hi !

Have you considered regular expressions in Python ?

Please take a look at "Regular Expression HOWTO", at
http://docs.python.org/howto/regex.html

All the best,
Hilton

On Thu, Jan 19, 2012 at 4:09 PM, Hs Hs <ilhs_hs at yahoo.com> wrote:

> Hi:
> I am writing to see if I could any help.
> I am trying to find if a mutation in gene falls in a polymer region of
> DNA. To explain in simplistic terms,
>
> Given a piece of DNA string, with following characters, I know where
> mutation happens.  Happens at T (in quotes with spaces.) 3 As before T and
> 4 As after T are removed in a disease.
>
> Given following sequence, I should be able to find if this T is in a
> polymer region. such as 'AAA' T 'AAAA.
>
> AAATAGCAGAAA 'T' AAAAGAAAAGATTGGAACTAGGTCAG
>
>
>
> I am not sure if there are any methods in python to find these.  Do you
> think a script has to be written with more logic involving some known
> algorithms.
>
> Please advise.
>
> thanks
> Hs.
>
> _______________________________________________
> Tutor maillist  -  Tutor at python.org
> To unsubscribe or change subscription options:
> http://mail.python.org/mailman/listinfo/tutor
>
>


-- 
(11)8131-5213
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.python.org/pipermail/tutor/attachments/20120119/453b1e6f/attachment.html>