concatenate fasta file

PeroMHC macmanes at gmail.com
Fri Feb 12 17:06:41 CET 2010


Hi All, I have  a simple problem that I hope somebody can help with. I
have an input file (a fasta file) that I need to edit..

Input file format

>name 1
tactcatacatac
>name 2
acggtggcat
>name 3
gggtaccacgtt

I need to concatenate the sequences.. make them look like

>concatenated
tactcatacatacacggtggcatgggtaccacgtt

thanks. Matt



More information about the Python-list mailing list