[Tutor] finding a polymer of letters in a string

[Hs Hs]

Hi: 
I am writing to see if I could any help.
I am trying to find if a mutation in gene falls in a polymer region of DNA. To explain in simplistic terms, 


Given a piece of DNA string, with following characters, I know where mutation happens.  Happens at T (in quotes with spaces.) 3 As before T and 4 As after T are removed in a disease. 


Given following sequence, I should be able to find if this T is in a polymer region. such as 'AAA' T 'AAAA. 


AAATAGCAGAAA 'T' AAAAGAAAAGATTGGAACTAGGTCAG



I am not sure if there are any methods in python to find these.  Do you think a script has to be written with more logic involving some known algorithms. 


Please advise. 


thanks
Hs.
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.python.org/pipermail/tutor/attachments/20120119/8cb38a4b/attachment.html>